A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.
cDNA:
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC TAATTTGTGTGTGGGTATA-CAGTATAATCATATA-3′
Genomic DNA (contains one intron):
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTA CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3′
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 12.21? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.
Can You Do My Homework for Me?
YES, ⚡ Experience the brilliance of our essay writers from the US, UK, Canada, or Australia by entrusting us with your next essay.
Essay Due Soon? Let Our Experts Help You Beat the Deadline!
Tell us about your assignment and we will find the best writer for your paper. Our Essay writing service covers over 243 courses and programs, catering to your specific needs.
Write My Essay For Me!NursingEssayHub.com is a distinguished ONLINE ESSAY WRITING AGENCY that specializes in offering expert writing help and assistance to students across all academic levels. With a team of highly skilled writers and editors boasting years of academic writing experience, we are fully equipped to guide you throughout the entire process, from selecting the perfect topic for your paper to completing a thorough literature review and delivering a well-formatted final draft.
ORDER A SIMILAR ESSAY WRITTEN FROM SCRATCH at : https://nursingessayhub.com/
