A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.
cDNA:
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC TAATTTGTGTGTGGGTATA-CAGTATAATCATATA-3′
Genomic DNA (contains one intron):
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTA CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3′
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 12.21? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.
Can You Do My Homework for Me?
YES, ⚡ Experience the brilliance of our essay writers from the US, UK, Canada, or Australia by entrusting us with your next essay.
Check before you submit. Get the Turnitin report your professor sees.
Get the exact same Turnitin report your professor uses. Join 50,000+ students who submitted their essays with confidence this semester.
NursingEssayHub.com is a distinguished ONLINE ESSAY WRITING AGENCY that specializes in offering expert writing help and assistance to students across all academic levels. With a team of highly skilled writers and editors boasting years of academic writing experience, we are fully equipped to guide you throughout the entire process, from selecting the perfect topic for your paper to completing a thorough literature review and delivering a well-formatted final draft.

ORDER A SIMILAR ESSAY WRITTEN FROM SCRATCH at : https://nursingessayhub.com/



